pBlueScript-humanAPOBEC1
(Plasmid
#134606)
-
PurposePlasmid bearing APOBEC1 coding sequence. In presence of its cofactor and overexpressing an artificial reporter with editable CAA codon in APOB sequence we can visualize its editing activity
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBlueScript
- Backbone size w/o insert (bp) 7168
- Total vector size (bp) 7879
-
Modifications to backboneAdded puromycin resistance and beta actin promoter
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanAPOBEC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)711
-
Entrez GeneAPOBEC1 (a.k.a. APO1, APOBEC-1, BEDP, CDAR1, HEPR)
- Promoter Beta actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer AAAGCTAGCATGACTTCTGAGAAAGGTCCT
- 3′ sequencing primer AAATGTACAAGATCTCATCTCCAAGCCACAGAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBlueScript-humanAPOBEC1 was a gift from Silvestro Conticello (Addgene plasmid # 134606 ; http://n2t.net/addgene:134606 ; RRID:Addgene_134606) -
For your References section:
Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803