VPR_dCas9
(Plasmid
#134601)
-
PurposeExpress CHO codon-optimized dCas9 fused to VPR for CRISPR activation. 2A linked ZsGreen1 marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ204
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 10240
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVPR-dCas9-2A-ZsGreen-DR
-
SpeciesSynthetic
-
Insert Size (bp)7449
- Promoter CMV
-
Tags
/ Fusion Proteins
- VPR (N terminal on insert)
- ZsGreen1-DR (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGTCGGTGTGTTGACATTGATTATTGACTA
- 3′ sequencing primer ACGCAAGTCCATAGAGCCCACCGCATCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVPR was cloned from Addgene plasmid # 68496
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPR_dCas9 was a gift from Lasse Ebdrup Pedersen (Addgene plasmid # 134601 ; http://n2t.net/addgene:134601 ; RRID:Addgene_134601) -
For your References section:
Awakening dormant glycosyltransferases in CHO cells with CRISPRa. Karottki KJC, Hefzi H, Xiong K, Shamie I, Hansen AH, Li S, Pedersen LE, Li S, Lee JS, Lee GM, Kildegaard HF, Lewis NE. Biotechnol Bioeng. 2020 Feb;117(2):593-598. doi: 10.1002/bit.27199. Epub 2019 Nov 12. 10.1002/bit.27199 PubMed 31631317