pLEX305_FKBP12F36V-SHOC2
(Plasmid #134522)

• Purpose: Lentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tag
• Depositing Lab: Andrew Aguirre
• Publication: Sulahian et al Cell Rep. 2019 Oct 1;29(1):118-134.e8. doi: 10.1016/j.celrep.2019.08.090.

Backbone

• Vector backbone: pLEX_305-N-dTAG
• Backbone size w/o insert (bp): 9621
• Total vector size (bp): 11367
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SHOC2
• Species: H. sapiens (human)
• Insert Size (bp): 1746
• Mutation: Silent mutations made at wobble base position at nucleotides 594, 600, 717, and 723 to prevent gRNA targeting
• GenBank ID: NM_007373.3
• Entrez Gene: SHOC2 (a.k.a. NSLH1, SIAA0862, SOC2, SUR8)
• Promoter: hPGK
• Tag / Fusion Protein:
  • FKBP12F36V-2xHA (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TGTTCCGCATTCTGCAAGCCTC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry