pBbAW4k-loxP-TT-loxP-mRFP1
(Plasmid #134405)

• Purpose: Fluorescent reporter for Cre recombinase activity. Cre removes a transcription terminator, leading to RFP production.
• Depositing Lab: Mary Dunlop
• Publication: Sheets et al ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21.

Backbone

• Vector backbone: pBbA-k
• Backbone size w/o insert (bp): 2432
• Total vector size (bp): 3445
• Vector type: Bacterial Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655
• Growth instructions: When transformed with Opto-Cre-Vvd, store in the dark.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: W4-loxP-TT-loxP-mRFP1
• Insert Size (bp): 1013
• Promoter: W4 (modified T7A1)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCTTCCCCATCGGTGATGTCG
• 3′ sequencing primer: TTTCGCCACCACTGATTTGAGC

Resource Information

• Supplemental Documents:
  • pbbaw4k-loxp-tt-loxp-mrfp1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/786533v1 for bioRxiv preprint.

Please note: This plasmid exists as a multimer. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers