pcDNA3.1.H1-NP
(Plasmid #134367)

• Purpose: Nanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.
• Depositing Lab: Julien Hanson
• Publication: Laschet et al J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6939
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H1-NP
• Alt name: HRH1-Natural peptide of NanoLuciferase
• Species: H. sapiens (human)
• Insert Size (bp): 1581
• GenBank ID:
• Entrez Gene: HRH1 (a.k.a. H1-R, H1R, HH1R, hisH1)
• Promoter: T7
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • natural peptide of nanoluciferase (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TTCCCAATCCTCCCCCTTG

Resource Information

• Supplemental Documents:
  • 408-pcDNA3.1.F.H1.seqWT.seqWT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry