pcDNA3.1.Gα13-LgB106
(Plasmid #134364)

• Purpose: Nanoluc complementation assay. Expression of Gα13 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 106 and 107 of Gα13. Addition of the HA epitope at N term of Gα13.
• Depositing Lab: Julien Hanson
• Publication: Laschet et al J Biol Chem. 2019 Mar 15;294(11):4079-4090. doi: 10.1074/jbc.RA118.006231. Epub 2018 Dec 28.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 7036
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Gα13-LgB106
• Species: H. sapiens (human)
• Insert Size (bp): 1683
• GenBank ID:
• Entrez Gene: GNA13 (a.k.a. G13, HG1N)
• Promoter: T7
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TTCCCAATCCTCCCCCTTG

Resource Information

• Supplemental Documents:
  • 401-pcDNA3.1.HA-Ga13-L106LgBit (linker publi).str

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry