AAVS1-TRE-SHH
(Plasmid #134350)

• Purpose: Targeting vector for site specific integration of doxycycline inducible expression of full length human SHH cDNA into human AAVS1 locus
• Depositing Lab: Lorenz Studer
• Publication: Cederquist et al Nat Biotechnol. 2019 Apr;37(4):436-444. doi: 10.1038/s41587-019-0085-3. Epub 2019 Apr 1.

Backbone

• Vector backbone: Puro-iDest
• Backbone size w/o insert (bp): 8904
• Total vector size (bp): 8681
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SHH
• Species: H. sapiens (human)
• Insert Size (bp): 1389
• GenBank ID: NM_000193.3
• Entrez Gene: SHH (a.k.a. HHG1, HLP3, HPE3, MCOPCB5, SMMCI, ShhNC, TPT, TPTPS)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTTTGTACAAAAAAGCAGGC (ATTB1)
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC (SV40pA-R)

Resource Information

• Supplemental Documents:
  • AAVS1-TRE-SHH (verified).gb
• A portion of this plasmid was derived from a plasmid made by: human SHH cDNA was purchased from Genecopoeia, Product ID:T1004

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Puro-iDEST (Addgene #75336)