-
PurposeMammalian acoustic reporter gene 1 cassette 3 on the piggyBac trasposon plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAF PB
- Total vector size (bp) 9002
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemARG 1 cassete 3
-
Alt nameMammalian acoustic reporter gene1 cassette 3
-
SpeciesBacillus megaterium
-
Insert Size (bp)2721
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6 Promoter
- 3′ sequencing primer GAGCCTCTACGACTCCGTGAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mARG1 cassette 3 was a gift from Mikhail Shapiro (Addgene plasmid # 134345 ; http://n2t.net/addgene:134345 ; RRID:Addgene_134345) -
For your References section:
Ultrasound imaging of gene expression in mammalian cells. Farhadi A, Ho GH, Sawyer DP, Bourdeau RW, Shapiro MG. Science. 2019 Sep 27;365(6460):1469-1475. doi: 10.1126/science.aax4804. 10.1126/science.aax4804 PubMed 31604277
Map uploaded by the depositor.
