Skip to main content
Addgene

mARG1 cassette 1
(Plasmid #134343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134343 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAF PB
  • Total vector size (bp) 6756
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mARG 1 cassete 1
  • Alt name
    Mammalian acoustic reporter gene1 cassette 1
  • Species
    Bacillus megaterium
  • Insert Size (bp)
    1571
  • Promoter TRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAAGGAAAACCACGTCCCCGT
  • 3′ sequencing primer CCCAGAAGGTACCCCATTGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mARG1 cassette 1 was a gift from Mikhail Shapiro (Addgene plasmid # 134343 ; http://n2t.net/addgene:134343 ; RRID:Addgene_134343)
  • For your References section:

    Ultrasound imaging of gene expression in mammalian cells. Farhadi A, Ho GH, Sawyer DP, Bourdeau RW, Shapiro MG. Science. 2019 Sep 27;365(6460):1469-1475. doi: 10.1126/science.aax4804. 10.1126/science.aax4804 PubMed 31604277