Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

3xFLAG-dCas9/pMSCVhyg
(Plasmid #134323)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134323 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMSCVhyg
  • Backbone manufacturer
    Takara Bio
  • Backbone size w/o insert (bp) 7133
  • Total vector size (bp) 11345
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-dCas9
  • Species
    Synthetic; Streptococcus pyogenes
  • Insert Size (bp)
    4212
  • Mutation
    human codon-optimized, D10A + H840A
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG tag (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Construction strategy of gRNA retroviral vectors

1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).

2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.

Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-dCas9/pMSCVhyg was a gift from Hodaka Fujii (Addgene plasmid # 134323 ; http://n2t.net/addgene:134323 ; RRID:Addgene_134323)
  • For your References section:

    MSCV-based retroviral plasmids expressing 3xFLAG-Sp-dCas9 for enChIP analysis. Yuno M, Nagata S, Fujita T, Fujii H. Biol Methods Protoc. 2021 Jul 9;6(1):bpab013. doi: 10.1093/biomethods/bpab013. eCollection 2021. 10.1093/biomethods/bpab013 PubMed 34409168