pFudio-Cpg15-IRES2-TdTomatoW
(Plasmid
#134309)
-
PurposeExpresses cpg15 and TdTomato upon coexpression with Cre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFUW
- Backbone size w/o insert (bp) 9534
- Total vector size (bp) 11995
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namecpg15
-
Alt nameNeuritin, Nrn1
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)465
-
GenBank IDNM_153529.2
-
Entrez GeneNrn1 (a.k.a. 0710008J23Rik, Cpg15, Nrn)
- Promoter UbC
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Nhe1 (not destroyed)
- 5′ sequencing primer GGACCCCGCCGCCCC
- 3′ sequencing primer CCGCCACCATGGGACTTAAGTTGAACGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTdTomato
-
SpeciesSynthetic
-
Insert Size (bp)1431
- Promoter UbC
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (not destroyed)
- 3′ cloning site Age1 (not destroyed)
- 5′ sequencing primer TTACTTGTACAGCTCGTCCATGCCG
- 3′ sequencing primer ACCGGTGCCACAACCATGGTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFudio-Cpg15-IRES2-TdTomatoW was a gift from Elly Nedivi (Addgene plasmid # 134309 ; http://n2t.net/addgene:134309 ; RRID:Addgene_134309) -
For your References section:
CPG15/Neuritin Mimics Experience in Selecting Excitatory Synapses for Stabilization by Facilitating PSD95 Recruitment. Subramanian J, Michel K, Benoit M, Nedivi E. Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012. 10.1016/j.celrep.2019.07.012 PubMed 31390571