pBAD-Citroff1-S245
(Plasmid
#134302)
-
PurposeBacterial expression of an inverse-response citrate sensor variant with medium binding affinity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134302 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5100
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCitroff1 S245A
-
SpeciesSynthetic
-
Insert Size (bp)1100
- Promoter pBAD
-
Tag
/ Fusion Protein
- 6-His tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-Citroff1-S245 was a gift from Robert Campbell (Addgene plasmid # 134302 ; http://n2t.net/addgene:134302 ; RRID:Addgene_134302) -
For your References section:
High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate. Zhao Y, Shen Y, Wen Y, Campbell RE. ACS Cent Sci. 2020 Aug 26;6(8):1441-1450. doi: 10.1021/acscentsci.0c00518. Epub 2020 Jul 9. 10.1021/acscentsci.0c00518 PubMed 32875085