pFudioFRTPSD-95TealW
(Plasmid #134299)

• Purpose: Expresses PSD95 fused to Teal fluorescent protein upon coexpression with the recombinase flippase (Flp)
• Depositing Lab: Elly Nedivi
• Publication: Subramanian et al Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012.

Backbone

• Vector backbone: pFUW
• Backbone size w/o insert (bp): 9452
• Total vector size (bp): 12389
• Modifications to backbone: Insert is inverted with respect to the promoter and is flanked by incompatible FRT sites (FRT1, FRT5).
• Vector type: Mammalian Expression, Lentiviral ; Flp/FRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PSD-95-Teal
• Alt name: SAP-90, DLG4
• Species: M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 2937
• Entrez Gene: Dlg4 (a.k.a. Dlgh4, PSD95, Sap90)
• Promoter: UbC
• Tag / Fusion Protein:
  • Teal (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (not destroyed)
• 3′ cloning site: Mlu1 (destroyed during cloning)
• 5′ sequencing primer: GTTGGCGAGTGTGTTTTGTG
• 3′ sequencing primer: CATTAAAGCAGCGTATCCAC

Resource Information

• Supplemental Documents:
  • Note on FLPe

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry