Skip to main content
Addgene

pMBP-parallel1-GK5_v2 (D443N)
(Plasmid #134293)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134293 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMBP-parallel1
  • Backbone size w/o insert (bp) 6700
  • Total vector size (bp) 8300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gk5
  • Alt name
    glycerol kinase 5 (putative)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1605
  • Mutation
    changed Aspartic Acid 443 to Asparagine
  • GenBank ID
    NM_001368879
  • Entrez Gene
    Gk5 (a.k.a. AV095337, C330018K18Rik, G630067D24Rik)
  • Promoter T7
  • Tag / Fusion Protein
    • MBP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer TGCTGCAAGGCGATTAAGTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBP-parallel1-GK5_v2 (D443N) was a gift from Bruce Beutler (Addgene plasmid # 134293 ; http://n2t.net/addgene:134293 ; RRID:Addgene_134293)
  • For your References section:

    Skin-specific regulation of SREBP processing and lipid biosynthesis by glycerol kinase 5. Zhang D, Tomisato W, Su L, Sun L, Choi JH, Zhang Z, Wang KW, Zhan X, Choi M, Li X, Tang M, Castro-Perez JM, Hildebrand S, Murray AR, Moresco EMY, Beutler B. Proc Natl Acad Sci U S A. 2017 Jun 27;114(26):E5197-E5206. doi: 10.1073/pnas.1705312114. Epub 2017 Jun 12. 10.1073/pnas.1705312114 PubMed 28607088