Skip to main content
Addgene

pLV-puro-N-3HA-SREBP1-C-Flag
(Plasmid #134286)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134286 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLV-EF1a -MCS-IRES-Puro
  • Backbone manufacturer
    BioSettia
  • Backbone size w/o insert (bp) 8900
  • Total vector size (bp) 12300
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SREBP1
  • Alt name
    Srebf1; bHLHd1; SREBP-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3405
  • Mutation
    mouse SREBP1 isoform a precursor
  • GenBank ID
    NM_011480
  • Entrez Gene
    Srebf1 (a.k.a. ADD1, SREBP1, bHLHd1)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • 3x HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cttccatttcaggtgtcgtg
  • 3′ sequencing primer ttaccctgttatccctaggc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-puro-N-3HA-SREBP1-C-Flag was a gift from Bruce Beutler (Addgene plasmid # 134286 ; http://n2t.net/addgene:134286 ; RRID:Addgene_134286)

  • For your References section:

    Skin-specific regulation of SREBP processing and lipid biosynthesis by glycerol kinase 5. Zhang D, Tomisato W, Su L, Sun L, Choi JH, Zhang Z, Wang KW, Zhan X, Choi M, Li X, Tang M, Castro-Perez JM, Hildebrand S, Murray AR, Moresco EMY, Beutler B. Proc Natl Acad Sci U S A. 2017 Jun 27;114(26):E5197-E5206. doi: 10.1073/pnas.1705312114. Epub 2017 Jun 12. 10.1073/pnas.1705312114 PubMed 28607088
Related items:
Commonly requested with: