Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant
(Plasmid #134252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134252 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-EF1a -MCS-IRES-Hyg
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10200
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Snrp40
  • Alt name
    Wdr57
  • Alt name
    Prp8bp
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    954
  • Mutation
    deleted amino acids 179-219, and mutated coding sequence “gataactatgcgacgttgaa” to “gaCaaTtaCgcCacCttAaa”
  • GenBank ID
    NM_025645
  • Entrez Gene
    Snrnp40 (a.k.a. 0610009C03Rik, Prp8bp, Wdr57)
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TTCGGCCAGTAACGTTAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant was a gift from Bruce Beutler (Addgene plasmid # 134252 ; http://n2t.net/addgene:134252 ; RRID:Addgene_134252)
  • For your References section:

    Syndromic immune disorder caused by a viable hypomorphic allele of spliceosome component Snrnp40. Zhang D, Yue T, Choi JH, Nair-Gill E, Zhong X, Wang KW, Zhan X, Li X, Choi M, Tang M, Quan J, Hildebrand S, Moresco EMY, Beutler B. Nat Immunol. 2019 Oct;20(10):1322-1334. doi: 10.1038/s41590-019-0464-4. Epub 2019 Aug 19. 10.1038/s41590-019-0464-4 PubMed 31427773