pBOB-N-Flag-Snrnp40-skywarp
(Plasmid
#134250)
-
PurposeLentivector encoding Flag-tagged skywarp form of Snrnp40 (missing exon 5)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBOB
- Backbone size w/o insert (bp) 8800
- Total vector size (bp) 9800
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSnrp40
-
Alt nameWdr57
-
Alt namePrp8bp
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)954
-
Mutationdeleted amino acids 179-219
-
GenBank IDNM_025645
-
Entrez GeneSnrnp40 (a.k.a. 0610009C03Rik, Prp8bp, Wdr57)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- Flag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer agctcgtttagtgaaccgtcagatcg
- 3′ sequencing primer ggaaactgacaatcttagcgcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOB-N-Flag-Snrnp40-skywarp was a gift from Bruce Beutler (Addgene plasmid # 134250 ; http://n2t.net/addgene:134250 ; RRID:Addgene_134250) -
For your References section:
Syndromic immune disorder caused by a viable hypomorphic allele of spliceosome component Snrnp40. Zhang D, Yue T, Choi JH, Nair-Gill E, Zhong X, Wang KW, Zhan X, Li X, Choi M, Tang M, Quan J, Hildebrand S, Moresco EMY, Beutler B. Nat Immunol. 2019 Oct;20(10):1322-1334. doi: 10.1038/s41590-019-0464-4. Epub 2019 Aug 19. 10.1038/s41590-019-0464-4 PubMed 31427773