pKM328
(Plasmid
#134243)
-
PurposeMammalian expression construct expressing sgRNA against PLK1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting PLK1 3'
-
gRNA/shRNA sequenceCAACGTTTTTGTACATGTTCGGGTG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM328 was a gift from Iain Cheeseman (Addgene plasmid # 134243 ; http://n2t.net/addgene:134243 ; RRID:Addgene_134243) -
For your References section:
Quiescent Cells Actively Replenish CENP-A Nucleosomes to Maintain Centromere Identity and Proliferative Potential. Swartz SZ, McKay LS, Su KC, Bury L, Padeganeh A, Maddox PS, Knouse KA, Cheeseman IM. Dev Cell. 2019 Oct 7;51(1):35-48.e7. doi: 10.1016/j.devcel.2019.07.016. Epub 2019 Aug 15. 10.1016/j.devcel.2019.07.016 PubMed 31422918