pFUdioFRTeYFPW
(Plasmid #133998)

• Purpose: expresses eYFP upon coexpression with the recombinase flippase (Flp)
• Depositing Lab: Elly Nedivi
• Publication: Subramanian et al Cell Rep. 2019 Aug 6;28(6):1584-1595.e5. doi: 10.1016/j.celrep.2019.07.012.

Backbone

• Vector backbone: pFUW
• Backbone size w/o insert (bp): 9194
• Total vector size (bp): 10172
• Vector type: Mammalian Expression, Lentiviral ; Flp/FRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eYFP
• Alt name: enhanced YFP
• Insert Size (bp): 720
• Mutation: inverted and flanked by two incompatible FRT sites (FRT1, FRT5)
• Promoter: UbC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: GTTGGCGAGTGTGTTTTGTG
• 3′ sequencing primer: CATTAAAGCAGCGTATCCAC

Resource Information

• Supplemental Documents:
  • Note on FLPe

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry