Skip to main content
Addgene

pSHDY*in_PpetE:BCD2:MrBBS:Strep
(Plasmid #133973)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133973 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSHDY*in
  • Backbone manufacturer
    Anna Behle, Dennis Dienst
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin and Spectinomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    growth temperature (37°C) referes to E. coli ; in Synechoccystis sp. PCC6803: 30 °C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MrBBS:StrepII
  • Alt name
    NheI_MrBBS_SynOpt2_Strep
  • Species
    Matricaria recutita
  • Mutation
    inserted gene is codon optimized for Synechocystis sp. PCC 6803 2nd/3rd amino acids of MrBBS changed from Ser/Thr to Ala/Ser
  • GenBank ID
    KJ020282
  • Promoter PpetE:BCD2
  • Tag / Fusion Protein
    • StrepII (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ccaggaattcgcggccgc
  • 3′ sequencing primer gctgccgcacagctccatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHDY*in_PpetE:BCD2:MrBBS:Strep was a gift from Pia Lindberg (Addgene plasmid # 133973 ; http://n2t.net/addgene:133973 ; RRID:Addgene_133973)
  • For your References section:

    High density cultivation for efficient sesquiterpenoid biosynthesis in Synechocystis sp. PCC 6803. Dienst D, Wichmann J, Mantovani O, Rodrigues JS, Lindberg P. Sci Rep. 2020 Apr 3;10(1):5932. doi: 10.1038/s41598-020-62681-w. 10.1038/s41598-020-62681-w PubMed 32246065