pBSWHhc-p53
(Plasmid
#133903)
-
PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWH
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBSWHhc
- Backbone size w/o insert (bp) 7495
- Total vector size (bp) 6803
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep53
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)960
-
GenBank ID
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter T7
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer TTATCCCTAGTTTAAACACCCATAATACCCATAATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBSWHhc-p53 was a gift from Sebastian Maurer (Addgene plasmid # 133903 ; http://n2t.net/addgene:133903 ; RRID:Addgene_133903) -
For your References section:
rec-YnH enables simultaneous many-by-many detection of direct protein-protein and protein-RNA interactions. Yang JS, Garriga-Canut M, Link N, Carolis C, Broadbent K, Beltran-Sastre V, Serrano L, Maurer SP. Nat Commun. 2018 Sep 14;9(1):3747. doi: 10.1038/s41467-018-06128-x. 10.1038/s41467-018-06128-x PubMed 30217970