Skip to main content
Addgene

pAW
(Plasmid #133893)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133893 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAW
  • Backbone size (bp) 9709
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer TTTCGTTTTAAAACCTAAGAGTC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW was a gift from Sebastian Maurer (Addgene plasmid # 133893 ; http://n2t.net/addgene:133893 ; RRID:Addgene_133893)

  • For your References section:

    rec-YnH enables simultaneous many-by-many detection of direct protein-protein and protein-RNA interactions. Yang JS, Garriga-Canut M, Link N, Carolis C, Broadbent K, Beltran-Sastre V, Serrano L, Maurer SP. Nat Commun. 2018 Sep 14;9(1):3747. doi: 10.1038/s41467-018-06128-x. 10.1038/s41467-018-06128-x PubMed 30217970
Related items: