pEGFP-N1-wtVHL
(Plasmid
#13389)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4695
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevon Hippel-Lindau
-
Alt nameVHL
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)572
-
GenBank IDNM_052801
-
Entrez GeneVhl (a.k.a. Vhlh)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer cggactcagatctcgagctcaa
- 3′ sequencing primer cgctgaacttgtggccgttt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMichael Lerman, NCI-Frederick
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note, EGFP is not fused to insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-wtVHL was a gift from Lucy Anderson (Addgene plasmid # 13389 ; http://n2t.net/addgene:13389 ; RRID:Addgene_13389) -
For your References section:
The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao YH, Resau JH, Nagashima K, Anderson LM, Ramakrishna G. Cancer Res. 2000 Jun 1. 60(11):2816-9. PubMed 10850420