pJBL7035
(Plasmid
#133870)
-
PurposeAtzB expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1763
- Total vector size (bp) 3209
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrows very slowly--2 days from colony to rich media even when uninduced
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtzB
-
SpeciesPseudomonas ADP-1
-
Insert Size (bp)1446
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcctggtatctttatagtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWas cloned by Twist Biosciences into specified pJL1 vector
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL7035 was a gift from Julius Lucks (Addgene plasmid # 133870 ; http://n2t.net/addgene:133870 ; RRID:Addgene_133870) -
For your References section:
Design and Optimization of a Cell-Free Atrazine Biosensor. Silverman AD, Akova U, Alam KK, Jewett MC, Lucks JB. ACS Synth Biol. 2020 Mar 20;9(3):671-677. doi: 10.1021/acssynbio.9b00388. Epub 2020 Mar 3. 10.1021/acssynbio.9b00388 PubMed 32078765