Skip to main content
Addgene

px459-RhebL1 sgRNA
(Plasmid #133769)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133769 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pspCas9(BB)-2A-Puro V2.0
  • Backbone manufacturer
    Addgene# 62988 from Feng Zhang
  • Backbone size w/o insert (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RhebL1 sgRNA
  • Alt name
    Ras Homolog Enriched In Brain-Like Protein 1 sgRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (unknown if destroyed)
  • 3′ cloning site Bbs1 (unknown if destroyed)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • 3′ sequencing primer gtgggcttgtactcggtcat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/513473v3 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459-RhebL1 sgRNA was a gift from Shawn Ferguson (Addgene plasmid # 133769 ; http://n2t.net/addgene:133769 ; RRID:Addgene_133769)
  • For your References section:

    Weak membrane interactions allow Rheb to activate mTORC1 signaling without major lysosome enrichment. Angarola B, Ferguson SM. Mol Biol Cell. 2019 Oct 15;30(22):2750-2760. doi: 10.1091/mbc.E19-03-0146. Epub 2019 Sep 18. 10.1091/mbc.E19-03-0146 PubMed 31532697