pEGFP-C1-RhebL1
(Plasmid
#133766)
-
PurposeExpresses GFP-tagged RhebL1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5284
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRhebL1
-
Alt nameRas Homolog Enriched In Brain-Like Protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)552
-
GenBank IDNM_144593.3
-
Entrez GeneRHEBL1 (a.k.a. RHEBL1c)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/513473v3 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-RhebL1 was a gift from Shawn Ferguson (Addgene plasmid # 133766 ; http://n2t.net/addgene:133766 ; RRID:Addgene_133766) -
For your References section:
Weak membrane interactions allow Rheb to activate mTORC1 signaling without major lysosome enrichment. Angarola B, Ferguson SM. Mol Biol Cell. 2019 Oct 15;30(22):2750-2760. doi: 10.1091/mbc.E19-03-0146. Epub 2019 Sep 18. 10.1091/mbc.E19-03-0146 PubMed 31532697