Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px459-TDP-43 sgRNA1
(Plasmid #133762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133762 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro V2.0
  • Backbone manufacturer
    Addgene# 62988 from Feng Zhang
  • Backbone size w/o insert (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TDP-43
  • Alt name
    TARDBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • GenBank ID
    nm_007375
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (unknown if destroyed)
  • 3′ cloning site Bbs1 (unknown if destroyed)
  • 5′ sequencing primer tttatggcgaggcggcgg
  • 3′ sequencing primer gtgggcttgtactcggtcat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459-TDP-43 sgRNA1 was a gift from Shawn Ferguson (Addgene plasmid # 133762 ; http://n2t.net/addgene:133762 ; RRID:Addgene_133762)
  • For your References section:

    Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135