pLVX-Puro-TDP-43-D169G
(Plasmid #133757)

• Purpose: Lentiviral expression of human TDP-43 D169G disease mutant in mammalian cells.
• Depositing Lab: Shawn Ferguson
• Publication: Roczniak-Ferguson et al Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct.

Backbone

• Vector backbone: plvx-puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8102
• Total vector size (bp): 9353
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TDP-43
• Alt name: TARDBP
• Species: H. sapiens (human)
• Insert Size (bp): 1215
• Mutation: Changed aspartate 169 to glycine.
• GenBank ID: NM_007375
• Entrez Gene: TARDBP (a.k.a. ALS10, TDP-43)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcgtgtacggtgggagg
• 3′ sequencing primer: gcatgctccagactgccttgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/560144v1 for bioRxiv preprint.