-
Purpose(Empty Backbone) Three-fragment Multisite Gateway vector construction for red fluorescent seed selection in Arabidopsis thaliana
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepFRm43GW
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgagcggataacaatttcacacagg
- 3′ sequencing primer ttacccgccaatatatcctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFRm43GW was a gift from Niko Geldner (Addgene plasmid # 133748 ; http://n2t.net/addgene:133748 ; RRID:Addgene_133748) -
For your References section:
An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420
