pTRE3G-Bi-β-chain
(Plasmid #133731)

• Purpose: Expresses the gePSI-β-chain and ZsGreen1 under control of the inducible bi-directional TRE3G promoter.
• Depositing Lab: Erin Schuman
• Publication: Heumuller et al Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0468-x. doi: 10.1038/s41592-019-0468-x.

Backbone

• Vector backbone: pTRE3G-BI-ZsGreen1
• Backbone manufacturer: TakaraBio Clontech
• Backbone size w/o insert (bp): 2839
• Total vector size (bp): 3847
• Modifications to backbone: The backbone for this plasmid is ‘pTRE3G-BI-ZsGreen1’ from the pTRE3G-BI-ZsGreen1 Vector Set (Cat. No. 631334) from TakaraBio Clontech. We inserted the gePSI-bChain downstream of the pTRE3G promoter using Gibson Cloning.
• Vector type: Mammalian Expression
• Selectable markers: No selectable marker

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: b-Chain_gePSI
• Species: Zea mays
• Insert Size (bp): 312
• Mutation: Only one part of the gePSI-system (startcodon + aa167-269)
• Promoter: pTRE3G-Bi

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGAACGTATAAGCTTTAGGC

Gene/Insert 2

• Gene/Insert name: ZsGreen1
• Species: Zoanthus sp.
• Insert Size (bp): 696
• Promoter: pTRE3G-Bi

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: -

Resource Information

• Supplemental Documents:
  • pTRE3G-Bi-b-chain.gbk
  • pTRE3G-Bi-b-chain_InsertInformation

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry