pLB(N)CX-FLAG-CH3 Del33
(Plasmid #133724)

• Purpose: Retroviral vector with CMV promoter driving mutant form of CH3 domain fragment of human p300 (EP300), with N-terminal FLAG tag.
• Depositing Lab: James A. DeCaprio
• Publication: Borger et al J Virol. 2006 May . 80(9):4292-303.

Backbone

• Vector backbone: pLB(N)CX
• Total vector size (bp): 6610
• Vector type: Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EP300
• Species: H. sapiens (human)
• Mutation: partial (not complete) p300 fragment, AT and CH3 domains only; deletion in CH3 domain (11 1737-1836), disrupts SC40 LT binding
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pLNXC F - agctcgtttagtgaaccgtcagatcg
• 3′ sequencing primer: pLNCX R - acctacaggtggggtctttcattccc

Resource Information

• Supplemental Documents:
  • Depositor Notes

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HMS clone ID number: HsCD00061646
Please see Supplemental Documents > Depositor Notes for more cloning information.