Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLB(N)CX-FLAG-CH3 Del33
(Plasmid #133724)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133724 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLB(N)CX
  • Total vector size (bp) 6610
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EP300
  • Species
    H. sapiens (human)
  • Mutation
    partial (not complete) p300 fragment, AT and CH3 domains only; deletion in CH3 domain (11 1737-1836), disrupts SC40 LT binding
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer pLNXC F - agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer pLNCX R - acctacaggtggggtctttcattccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HMS clone ID number: HsCD00061646
Please see Supplemental Documents > Depositor Notes for more cloning information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLB(N)CX-FLAG-CH3 Del33 was a gift from James A. DeCaprio (Addgene plasmid # 133724 ; http://n2t.net/addgene:133724 ; RRID:Addgene_133724)
  • For your References section:

    Targeting of p300/CREB binding protein coactivators by simian virus 40 is mediated through p53. Borger DR, DeCaprio JA. J Virol. 2006 May . 80(9):4292-303. 10.1128/JVI.80.9.4292-4303.2006 PubMed 16611888