GWF297
(Plasmid
#133612)
-
PurposeTET3G-2xMS2(wt+f6), NLS-MCP-ANR-ANR-P2a-BFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJZC34
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET3G-2xMS2(wt+f6), MCP-ANR-ANR, BFP
-
gRNA/shRNA sequenceGTACGTTCTCTATCACTGATA
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GWF297 was a gift from Dustin Maly (Addgene plasmid # 133612 ; http://n2t.net/addgene:133612 ; RRID:Addgene_133612) -
For your References section:
Multi-input chemical control of protein dimerization for programming graded cellular responses. Foight GW, Wang Z, Wei CT, Jr Greisen P, Warner KM, Cunningham-Bryant D, Park K, Brunette TJ, Sheffler W, Baker D, Maly DJ. Nat Biotechnol. 2019 Sep 9. pii: 10.1038/s41587-019-0242-8. doi: 10.1038/s41587-019-0242-8. 10.1038/s41587-019-0242-8 PubMed 31501561