pHD-SPARC2-D-LexA::p65
(Plasmid
#133562)
-
PurposeSwap out effector and terminator to generate SPARC2-D CRISPR-donor vector for CRISPR-HDR genomic insertion near the attP40 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHD-3XP3-DsRed-DattP-CRISPR-donor-attP40
-
Backbone manufacturerIsaacman-Beck et al., 2019
- Backbone size w/o insert (bp) 8329
- Total vector size (bp) 10029
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexA::p65
- Promoter 20X UAS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGACTACCTGGCCGTTCCT
- 3′ sequencing primer AGCGACCACCCGATCCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/788679v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD-SPARC2-D-LexA::p65 was a gift from Tom Clandinin (Addgene plasmid # 133562 ; http://n2t.net/addgene:133562 ; RRID:Addgene_133562) -
For your References section:
SPARC enables genetic manipulation of precise proportions of cells. Isaacman-Beck J, Paik KC, Wienecke CFR, Yang HH, Fisher YE, Wang IE, Ishida IG, Maimon G, Wilson RI, Clandinin TR. Nat Neurosci. 2020 Sep;23(9):1168-1175. doi: 10.1038/s41593-020-0668-9. Epub 2020 Jul 20. 10.1038/s41593-020-0668-9 PubMed 32690967