pMW#3
(Plasmid #13350)

• Depositing Lab: Marian Walhout
• Publication: Deplancke et al Cell. 2006 Jun 16. 125(6):1193-205.

Backbone

• Vector backbone: pLacZi
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 9700
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: DB3.1 (Invitrogen)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LacZ reporter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GTTCGGAGATTACCGAATCAA (1HIFW)
• 3′ sequencing primer: ATGCGCTCAGGTCAAATTCAGA (LacZ592RV)

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note mutation R15H in ccdB was found during Addgene's quality control process. The plasmid should function as reported in the associated publication.

Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation.

Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a LacZ reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols.