-
PurposeExpresses SpyCatcher003-superfolder GFP in bacterial cytoplasm
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ404
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5136
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher003-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)1149
- Promoter T5
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- TEV site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer lacOT5 (Gcgctcacaattccacaacggtttccc)
- 3′ sequencing primer Term2 (CGAAAGGCTCAGTCGAAAGAC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpyCatcher003-sfGFP was a gift from Mark Howarth (Addgene plasmid # 133449 ; http://n2t.net/addgene:133449 ; RRID:Addgene_133449) -
For your References section:
Approaching infinite affinity through engineering of peptide-protein interaction. Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, Hytonen VP, Howarth M. Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116. 10.1073/pnas.1909653116 PubMed 31822621