Skip to main content
Addgene

human ETV6 gRNA-3
(Plasmid #133403)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133403 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    gRNA_Cloning Vector(Addgene#41824)
  • Backbone manufacturer
    George Church
  • Backbone size w/o insert (bp) 3915
  • Total vector size (bp) 3973
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ETV6
  • gRNA/shRNA sequence
    GGCGTCGAGGAAGCGTAACT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ETV6 (a.k.a. TEL, TEL/ABL, THC5)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human ETV6 gRNA-3 was a gift from Linzhao Cheng (Addgene plasmid # 133403 ; http://n2t.net/addgene:133403 ; RRID:Addgene_133403)

  • For your References section:

    Conditional gene knockout and reconstitution in human iPSCs with an inducible Cas9 system. Wu M, Liu S, Gao Y, Bai H, Machairaki V, Li G, Chen T, Cheng L. Stem Cell Res. 2018 May;29:6-14. doi: 10.1016/j.scr.2018.03.003. Epub 2018 Mar 10. 10.1016/j.scr.2018.03.003 PubMed 29554589
Related items: