Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BII-Sh-PIR702W
(Plasmid #133361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133361 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BII-sh-PIR702W
  • Backbone manufacturer
    Madison Lab
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IRFP-702
  • gRNA/shRNA sequence
    GGAGACGCTCGACCCGTCTCG
  • Species
    Other
  • Mutation
    N/A
  • Promoter CMV enhancer and hEf1a (CpG free)
  • Tag / Fusion Protein
    • HA-tagged IRFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.10.14.339531 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BII-Sh-PIR702W was a gift from Blair Madison (Addgene plasmid # 133361 ; http://n2t.net/addgene:133361 ; RRID:Addgene_133361)
  • For your References section:

    The oncogenic function of PLAGL2 is mediated via ASCL2 and IGF2 and a Wnt-independent mechanism in colorectal cancer. Fischer AD, Veronese-Paniagua DA, Swaminathan S, Kashima H, Rubin DC, Madison BB. Am J Physiol Gastrointest Liver Physiol. 2023 Jun 13. doi: 10.1152/ajpgi.00058.2022. 10.1152/ajpgi.00058.2022 PubMed 37310750