human ETV6 gRNA-1
(Plasmid
#133353)
-
Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonegRNA_Cloning Vector(Addgene#41824)
-
Backbone manufacturerGeorge Church
- Backbone size w/o insert (bp) 3915
- Total vector size (bp) 3973
-
Modifications to backboneNone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameETV6
-
gRNA/shRNA sequenceGTCTCACAGCGAGAGAGATC
-
SpeciesH. sapiens (human)
-
Entrez GeneETV6 (a.k.a. TEL, TEL/ABL, THC5)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human ETV6 gRNA-1 was a gift from Linzhao Cheng (Addgene plasmid # 133353 ; http://n2t.net/addgene:133353 ; RRID:Addgene_133353) -
For your References section:
Conditional gene knockout and reconstitution in human iPSCs with an inducible Cas9 system. Wu M, Liu S, Gao Y, Bai H, Machairaki V, Li G, Chen T, Cheng L. Stem Cell Res. 2018 May;29:6-14. doi: 10.1016/j.scr.2018.03.003. Epub 2018 Mar 10. 10.1016/j.scr.2018.03.003 PubMed 29554589