pNEXdelta-EGFP-ApAF
(Plasmid
#13335)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 13335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNEXdelta
- Backbone size w/o insert (bp) 2800
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAplysia activating factor
-
SpeciesA. kurodai
-
Insert Size (bp)1830
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACGCGTCGACGCCACCACCATGATATCCAGCATTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The order of restriction sites is: HindIII, EGFP (750bp), SalI, ApAF (1080bp), BamHI.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNEXdelta-EGFP-ApAF was a gift from Bong-Kiun Kaang (Addgene plasmid # 13335 ; http://n2t.net/addgene:13335 ; RRID:Addgene_13335) -
For your References section:
PKA-activated ApAF-ApC/EBP heterodimer is a key downstream effector of ApCREB and is necessary and sufficient for the consolidation of long-term facilitation. Lee JA, Lee SH, Lee C, Chang DJ, Lee Y, Kim H, Cheang YH, Ko HG, Lee YS, Jun H, Bartsch D, Kandel ER, Kaang BK. J Cell Biol. 2006 Sep 11. 174(6):827-38. 10.1083/jcb.200512066 PubMed 16966424