Skip to main content
Addgene

pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA- Pconstitutive-sgRNA(Sth3)_blaA
(Plasmid #133347)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133347 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBXMCS-2
  • Backbone size w/o insert (bp) 5287
  • Total vector size (bp) 6016
  • Modifications to backbone
    xylR operator removed
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA_cpaA and sgRNA_blaA
  • gRNA/shRNA sequence
    cpaA and blaA
  • Species
    Streptococcus thermophilus
  • Promoter constitutive

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTGATGCCGCTGGCGATTCAG
  • 3′ sequencing primer TTTTCCCAGTCACGACGTTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA- Pconstitutive-sgRNA(Sth3)_blaA was a gift from Michael Laub (Addgene plasmid # 133347 ; http://n2t.net/addgene:133347 ; RRID:Addgene_133347)
  • For your References section:

    A CRISPR Interference System for Efficient and Rapid Gene Knockdown in Caulobacter crescentus. Guzzo M, Castro LK, Reisch CR, Guo MS, Laub MT. mBio. 2020 Jan 14;11(1):e02415-19. doi: 10.1128/mBio.02415-19. 10.1128/mBio.02415-19 PubMed 31937638