pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
(Plasmid #133339)

• Purpose: for constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentus
• Depositing Lab: Michael Laub
• Publication: Guzzo et al mBio. 2020 Jan 14;11(1):e02415-19. doi: 10.1128/mBio.02415-19.

Backbone

• Vector backbone: pBXMCS-2
• Backbone size w/o insert (bp): 5287
• Total vector size (bp): 5516
• Modifications to backbone: xylR operator removed
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA_ctrA
• gRNA/shRNA sequence: ctrA
• Species: Streptococcus thermophilus
• Promoter: constitutive

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCTGATCCTCGCCCGAAAC
• 3′ sequencing primer: TTTTCCCAGTCACGACGTTG

Resource Information

• Supplemental Documents:
  • pBX The3 sgRNA_ctrA_addgenemap.gb
• A portion of this plasmid was derived from a plasmid made by: Jeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry