pXGFPC-5 Pxyl-dcas9 (Sth3)
(Plasmid #133317)

• Purpose: expresses dcas9 (Streptococcus thermophilus #3); repressed with 0.2% glucose, induced with 0.3% xylose; for homologous recombination at the xyl locus in Caulobacter crescentus; tetracycline resistance
• Depositing Lab: Michael Laub
• Publication: Guzzo et al mBio. 2020 Jan 14;11(1):e02415-19. doi: 10.1128/mBio.02415-19.

Backbone

• Vector backbone: pXGFPC-5
• Backbone size w/o insert (bp): 6296
• Total vector size (bp): 10463
• Vector type: Unspecified

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dcas9 (Streptococcus thermophilus #3)
• Species: Streptococcus thermophilus
• Insert Size (bp): 4167
• Promoter: xylose

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGGTCAGACAACCTACTTGCCGTC
• 3′ sequencing primer: TCGGCTGCGGCGAGCGGTATCA

Resource Information

• Supplemental Documents:
  • pXGFPC-5_The3_dcas9_addgenemap.gb
• A portion of this plasmid was derived from a plasmid made by: Jeremy M. Rock "Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform" Nature microbiology 2017

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry