Skip to main content
Addgene

pMKV059
(Plasmid #133314)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133314 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRANS_201
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luc+, IPT
  • Species
    Agrobacterium, Firefly
  • Promoter AtUbi10, 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AarI (destroyed during cloning)
  • 3′ cloning site AarI (destroyed during cloning)
  • 5′ sequencing primer taccctccgcgagatcatcc
  • 3′ sequencing primer aacgtcagaagccgactgc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    synthesized

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMKV059 was a gift from Daniel Voytas (Addgene plasmid # 133314 ; http://n2t.net/addgene:133314 ; RRID:Addgene_133314)
  • For your References section:

    Plant gene editing through de novo induction of meristems. Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF. Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi: 10.1038/s41587-019-0337-2. 10.1038/s41587-019-0337-2 PubMed 31844292