TLCV2-Exoc7-Ex5&10
(Plasmid #133303)

• Purpose: EGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.
• Depositing Lab: Jingshi Shen
• Publication: Wang et al J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18.

Backbone

• Vector backbone: TLCV2
• Backbone manufacturer: Adam Karpf
• Backbone size w/o insert (bp): 16733
• Total vector size (bp): 14608
• Modifications to backbone: EGFP reporter sequence was removed from TLCV2 (Addgene, #87360). Next, one gRNA targeting the mouse Exoc7 gene was subcloned into the BsmbI site of the modified TLCV2 vector. Meanwhile, the second gRNA targeting mouse Exoc7 was subcloned into the BbsI site of the pmU6-gRNA vector (Addgene, #53187). Next, the expression cassette of the second gRNA, including the mU6 promoter, the gRNA and the gRNA scaffold, was amplified by PCR with KpnI sites introduced at both ends. The PCR product was subcloned into the KpnI site of the modified TLCV2 vector containing the first gRNA.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Exocyst complex component 7
• Alt name: Exo70
• gRNA/shRNA sequence: mExoc7Ex5 (AGAAGCTGCTGTTTGAGCGA); mExoc7Ex10 (TTCTAGAGCTTTGGCCCCAA)
• Species: M. musculus (mouse)
• Entrez Gene: Exoc7 (a.k.a. Exo70, sec70)
• Promoter: mU6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: mU6For (atagatccgacgccgcca)

Resource Information

• Supplemental Documents:
  • TLCV2-Exoc7-Ex5&10.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry