Skip to main content
Addgene

TLCV2-Exoc7-Ex5&10
(Plasmid #133303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133303 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TLCV2
  • Backbone manufacturer
    Adam Karpf
  • Backbone size w/o insert (bp) 16733
  • Total vector size (bp) 14608
  • Modifications to backbone
    EGFP reporter sequence was removed from TLCV2 (Addgene, #87360). Next, one gRNA targeting the mouse Exoc7 gene was subcloned into the BsmbI site of the modified TLCV2 vector. Meanwhile, the second gRNA targeting mouse Exoc7 was subcloned into the BbsI site of the pmU6-gRNA vector (Addgene, #53187). Next, the expression cassette of the second gRNA, including the mU6 promoter, the gRNA and the gRNA scaffold, was amplified by PCR with KpnI sites introduced at both ends. The PCR product was subcloned into the KpnI site of the modified TLCV2 vector containing the first gRNA.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exocyst complex component 7
  • Alt name
    Exo70
  • gRNA/shRNA sequence
    mExoc7Ex5 (AGAAGCTGCTGTTTGAGCGA); mExoc7Ex10 (TTCTAGAGCTTTGGCCCCAA)
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Exoc7 (a.k.a. Exo70, sec70)
  • Promoter mU6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer mU6For (atagatccgacgccgcca)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TLCV2-Exoc7-Ex5&10 was a gift from Jingshi Shen (Addgene plasmid # 133303 ; http://n2t.net/addgene:133303 ; RRID:Addgene_133303)
  • For your References section:

    Inducible Exoc7/Exo70 knockout reveals a critical role of the exocyst in insulin-regulated GLUT4 exocytosis. Wang S, Crisman L, Miller J, Datta I, Gulbranson DR, Tian Y, Yin Q, Yu H, Shen J. J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18. 10.1074/jbc.RA119.010821 PubMed 31740584