pT3-EF1α-Dest
(Plasmid
#133299)
-
Purpose(Empty Backbone) The pT3-EF1α destination vector without any insert which can be used for LR reaction.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepT3-EF1α-Dest
- Backbone size (bp) 6783
-
Vector typeMammalian Expression
- Promoter EF1α
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF-1aforward: TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer pcDNA3.1BGHRev: TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-EF1α-Dest was a gift from Xin Chen (Addgene plasmid # 133299 ; http://n2t.net/addgene:133299 ; RRID:Addgene_133299) -
For your References section:
Integration of genomic analysis and in vivo transfection to identify sprouty 2 as a candidate tumor suppressor in liver cancer. Lee SA, Ho C, Roy R, Kosinski C, Patil MA, Tward AD, Fridlyand J, Chen X. Hepatology. 2008 Apr;47(4):1200-10. doi: 10.1002/hep.22169. 10.1002/hep.22169 PubMed 18214995
Map uploaded by the depositor.
