Skip to main content
Addgene

SHC003BSD-EXOC7
(Plasmid #133298)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133298 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    SHC003
  • Backbone size w/o insert (bp) 8347
  • Total vector size (bp) 9634
  • Modifications to backbone
    The selection marker in mammalian cells was modified as blasticidin, the EGFP reporter sequence was removed. EXOC7 gene with 3XFLAG conjugated was inserted into the vector.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Exocyst complex component 7
  • Alt name
    EXO70
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2056
  • Entrez Gene
    EXOC7 (a.k.a. 2-5-3p, BLOM4, EX070, EXO70, EXOC1, Exo70p, NEDSEBA, YJL085W)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • 3XFLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer cmvFor (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SHC03CMVRev (CTTCACCGGCATCTGCATCC)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SHC003BSD-EXOC7 was a gift from Jingshi Shen (Addgene plasmid # 133298 ; http://n2t.net/addgene:133298 ; RRID:Addgene_133298)

  • For your References section:

    Inducible Exoc7/Exo70 knockout reveals a critical role of the exocyst in insulin-regulated GLUT4 exocytosis. Wang S, Crisman L, Miller J, Datta I, Gulbranson DR, Tian Y, Yin Q, Yu H, Shen J. J Biol Chem. 2019 Dec 27;294(52):19988-19996. doi: 10.1074/jbc.RA119.010821. Epub 2019 Nov 18. 10.1074/jbc.RA119.010821 PubMed 31740584
Related items: