pRRLSIN.cPPT.PGK-GFP-PTS1.WPRE
(Plasmid #133282)

• Purpose: Lentiviral expression of a peroxisomal eGFP
• Depositing Lab: Etienne Sokal
• Publication: Demaret et al Histochem Cell Biol. 2020 Mar 2. pii: 10.1007/s00418-020-01855-z. doi: 10.1007/s00418-020-01855-z.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Trono Lab
• Backbone size w/o insert (bp): 7388
• Total vector size (bp): 7530
• Modifications to backbone: Peroxisome targeting signal 1 addition at the C-terminal of the eGFP
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: eGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Peroxisome targeting signal 1
• Alt name: SKL (serine-lysine-leucine)
• Alt name: Peroxisomal localization for the eGFP
• Insert Size (bp): 142
• Promoter: None
• Tag / Fusion Protein:
  • Peroxisome targeting signal 1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTGTTCCGCATTCTGCAAG
• 3′ sequencing primer: AGCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Original plasmids come from AddGene (pEGFP-C1+SKL (Plasmid #53450) & pRRLSIN.cPPT.PGK-GFP.WPRE (Plasmid #12252))

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We are grateful to Trono lab members and Jay Brenman lab members for sharing the original plasmids used to make this plasmid.