Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Raichu-OsRac1 CA
(Plasmid #133264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBI221
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsRac1(G19V)
  • Species
    Oryza sativa
  • Mutation
    OsRac1 G19V
  • Entrez Gene
    LOC4325879 (a.k.a. OSNPB_010229400, OsRac1, Rac1)
  • Promoter Ubi
  • Tags / Fusion Proteins
    • Venus-CRIB (N terminal on insert)
    • CFP-lipid (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pBI221 35S: ACTGACGTAAGGGATGACGC
  • 3′ sequencing primer NosTer R 2: GATAATCATCGCAAGACCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Raichu-OsRac1 CA was a gift from Yoji Kawano (Addgene plasmid # 133264 ; http://n2t.net/addgene:133264 ; RRID:Addgene_133264)
  • For your References section:

    In vivo monitoring of plant small GTPase activation using a Forster resonance energy transfer biosensor. Wong HL, Akamatsu A, Wang Q, Higuchi M, Matsuda T, Okuda J, Kosami KI, Inada N, Kawasaki T, Kaneko-Kawano T, Nagawa S, Tan L, Kawano Y, Shimamoto K. Plant Methods. 2018 Jul 7;14:56. doi: 10.1186/s13007-018-0325-4. eCollection 2018. 10.1186/s13007-018-0325-4 PubMed 30002723