pJFRC7-UAS-NPRR_dTK
(Plasmid
#133244)
-
PurposeFluorescent reporter for neuropeptide release imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJFRC7
- Backbone size w/o insert (bp) 8100
- Total vector size (bp) 10380
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedrosophila tachykinin-fused codon-optimized GCaMP6s
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2300
- Promoter hsp70
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aactactgaaatctgccaagaagtaatt
- 3′ sequencing primer tttgtccaattatgtcacaccacag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC7-UAS-NPRR_dTK was a gift from David Anderson (Addgene plasmid # 133244 ; http://n2t.net/addgene:133244 ; RRID:Addgene_133244) -
For your References section:
Imaging neuropeptide release at synapses with a genetically engineered reporter. Ding K, Han Y, Seid TW, Buser C, Karigo T, Zhang S, Dickman DK, Anderson DJ. Elife. 2019 Jun 26;8. pii: 46421. doi: 10.7554/eLife.46421. 10.7554/eLife.46421 PubMed 31241464