pJFRC7-UAS-NPRR_ANP
(Plasmid #133243)

• Purpose: Fluorescent reporter for neuropeptide release imaging
• Depositing Lab: David Anderson
• Publication: Ding et al Elife. 2019 Jun 26;8. pii: 46421. doi: 10.7554/eLife.46421.

Backbone

• Vector backbone: pJFRC7
• Backbone size w/o insert (bp): 8100
• Total vector size (bp): 9960
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rat atrial natriuretic peptide-fused codon-optimized GCaMP6s
• Species: R. norvegicus (rat), D. melanogaster (fly)
• Insert Size (bp): 1800
• Promoter: hsp70

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aactactgaaatctgccaagaagtaatt
• 3′ sequencing primer: tttgtccaattatgtcacaccacag

Resource Information

• Supplemental Documents:
  • NPRR_ANP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS analysis identified a sequence discrepancy at nucleotide 7954, resulting in an A201S mutation in the plasmid insert. The depositing lab has indicated that this should not affect plasmid function.